In human genetics, Haplogroup Q (M242) is a Y-chromosome DNA haplogroup.

Haplogroup Q is a branch of haplogroup P (M45). It is believed to have arisen in Siberia approximately 15,000 to 20,000 years ago.

This haplogroup contains many Siberians, Central Asians, and indigenous peoples of the Americas. Haplogroup Q Y-chromosomes are also found scattered at a low frequency throughout Eurasia.^[1] This haplogroup is diverse despite its low frequency among most populations outside of Siberia or the Americas, and at least six primary subclades have been sampled and identified in modern populations.

[edit] Distribution

In the Old World, the Q lineage and its many branches is largely found within a huge triangle defined by Norway in the northwest, the Iranian plateau in the south, and northern China in the east, northeastern Europe and central Asia being bound by this triangle. Haplogroup Q also has been detected in Yemenite Jews, Algerians, Arabians, Lebanese, Turks, Indians, Sri Lankans, Nepalese, Tibetans, Vietnamese, southern Chinese, Koreans, and Japanese. The frequency of Q in Norway and northern China is about 4%, with Chinese samples of haplogroup Q belonging almost exclusively to the subclade Q1a1-M120.^[2][3] 3% of Hungarian males are in haplogroup Q; it is believed this was a modal haplogroup of either the Huns, ancient Magyars or both. In Iran, the frequency runs between approximately 2.6% in the south and 9.1% in the north; Iranian samples of haplogroup Q belong almost exclusively to the subclade Q1a2-M25.^[4] In Pakistan, at the eastern end of the Iranian plateau, the frequency of haplogroup Q is about 2.2% (14/638)^[5] or 3.4% (6/176).^[6] Haplogroup Q has been found in approximately 4% of Southern Altaians and 32% of Northern Altaians,^[7] 16% of Tuvans,^[8] and 3% of Uyghurs,^[9] all of which are Turkic peoples inhabiting parts of Central Asia and southern Siberia. Haplogroup Q is found in approximately 3% of males in Tibet^[10] and Mongolia,^[9] approximately 2.5% of males in Saudi Arabia,^[11] and approximately 2% of males in Turkey,^[12] Lebanon,^[13] and the United Arab Emirates.^[14] Only two groups in the Old World are majority Q groups. These are the Selkups (~70%) and Kets (~95%). They live in western and middle Siberia and are small in number, being just under 5,000 and 1,500, respectively.

In a most recent study Gokcumen finds that among Turks that belong to the Afshar tribe haplogroup Q is seen with a prevalence of 13%.^[15]

[edit] Subclade Q1a3a (Q3)

A migration from Asia into Alaska across the Bering Strait was done by haplogroup Q populations approximately 20,000 to 15,000 years ago.^[1] This founding population spread throughout the Americas. In the Americas, a member of the founding population underwent a mutation, producing its descendant population defined by the M3 single nucleotide polymorphism (SNP).^[1]

[edit] Discovery of ancestral Q in the Indian subcontinent

A Biomed study observed an ancestral state Q* and a novel sub-branch Q5, not reported elsewhere, in the Indian subcontinent, though in low frequency.^[16] A novel subgroup Q4 was identified recently which is also restricted to the Indian subcontinent. The most plausible explanation for these observations could be an ancestral migration of individuals bearing ancestral lineage Q* to the Indian subcontinent followed by an autochthonous differentiation to Q4 and Q5 sublineages later on. Thus the subcontinent has three novel Q lineages, an ancestral Q* (different from the Central Asian Q*), Q4 and Q5 unique to the subcontinent. However, the recent ISOGG tree lacks the representation of Q5 (defined by ss4 bp, rs41352448) .^[16] Haplogroup Q4 is shown as Q1a3 (defined by M346) in the recent ISOGG tree. Taking the relationship of Q4 (M346) and Q5 (ss4bp) into consideration,^[16] Q5 may be positioned as Q1a7.

[edit] Technical specification of mutation

The technical details of M242 are:

Nucleotide change: C to T

Position (base pair): 180

Total size (base pairs): 366

Forward 5′→ 3′: aactcttgataaaccgtgctg

Reverse 5′→ 3′: tccaatctcaattcatgcctc

[edit] Subgroups

The subclades of Haplogroup Q with their defining mutation(s), according to the 2008 ISOGG tree are provided below. Subclade Q1a7 (ss4 bp, rs41352448) is not represented in the ISOGG 2008 tree because it is a value for an STR. This low frequency value been found as a novel Q lineage (Q5) in indian populations.^[16]

The 2008 ISOGG tree

• Q (M242)
  • Q*
  • Q1 (P36.2)
    • Q1*
    • Q1a (MEH2)
      • Q1a*
      • Q1a1 (M120, M265/N14) Found with low frequency among Han Chinese,^[2][3] Dungans,^[17] Hazaras,^[6] Japanese,^[18] Koreans,^[17] and Tibetans^[3][10]
      • Q1a2 (M25, M143) Found with low to moderate frequency in Iran,^[4] Lebanon,^[19] and Turkey^[12]
      • Q1a3 (M346)
        • Q1a3* Found with low frequency in Pakistan,^[6] India,^[6] the United Arab Emirates,^[14] Khanty,^[20] and Tibetans^[10]
        • Q1a3a (M3) Typical of indigenous peoples of the Americas^[21]
          • Q1a3a*
          • Q1a3a1 (M19) Found among some indigenous peoples of South America, such as the Ticuna and the Wayuu^[22]
          • Q1a3a2 (M194)
          • Q1a3a3 (M199, P106, P292)
      • Q1a4 (P48)
      • Q1a5 (P89)
      • Q1a6 (M323) Found in a significant minority of Yemenite Jews^[23]
    • Q1b (M378) Found in 5% of Ashkenazi Jews and with low frequency in Pakistan among samples of Hazaras and Sindhis^[24][6]

[edit] See also

• Populations
  • Hazara
  • Selkups
  • Ticuna
  • Indian populations

• Genetics
  • Haplogroup
  • Haplotype
  • subclade
  • Paragroup

• • Q1a3a (The only Y Chromosome haplogroup strictly associated with the indigenous peoples of the Americas.^[25])
• Paleo-Indians

[edit] References

[edit] External links

• Q Y-Haplogroup Project
• American Indian Q3 project at FTDNA
• Spread of Haplogroup Q, from The Genographic Project, National Geographic
• The India Genealogical DNA Project
• British Isles DNA Project
• Ysearch - the number one Y-DNA public database