Haplogroup J (Y-DNA) Information & Haplogroup J (Y-DNA) Links at HealthHaven.com
advertise
add site
services
publishers
database
health videos
Bookmark and Share

search wiki for    ?
web dir firms image gallery news hov pdf wiki shop video 
about
toolbar
stats
live show
health store
more stuff
JOIN/LOGIN
Featured Results:
Buerger's disease study, DNA testing Buerger's disease, MDL DNA...
Buerger's disease study, DNA testing Buerger's disease, MDL DNA...
mdl-labs.com
 
Haplogroup J

Distribution Haplogroup J Y-DNA.svg




Descendants J1, J2
Defining mutations 12f2.1, M304, P209, S6, S34, S35

In human genetics, Haplogroup J (previously known as HG9 or Eu9/Eu10) is a Y-chromosome DNA haplogroup. It is defined by the 12f2.1 genetic marker, or the equivalent M304 marker.

Contents

[edit] Origins

Haplogroup J is believed to have arisen roughly 30,000 years ago in Southwest Asia (31,700±12,800 years ago according to Semino et al.. 2004). It is most closely related to Haplogroup I, as both Haplogroup I and Haplogroup J have mutations in common deriving from Haplogroup IJ (S2, S22). Haplogroup IJ and haplogroup K derive from Haplogroup IJK (L15/S137, L16/S138), and only at this level of classification does haplogroup IJK join with Haplogroup G and Haplogroup H as immediate descendants of Haplogroup F. The main current subgroups J1 and J2, which now comprise between them almost all of the population of the haplogroup, are both believed to have arisen very early, at least 10,000 years ago.

Haplogroup J is found in greatest concentration in Southwest Asia. Outside of this region, haplogroup J has a moderate presence in Southern Europe (especially in central and southern Italy, Malta, Greece, and Albania), Central Asia, and South Asia, particularly in the form of its subclade J2 (J-M172). Haplogroup J is also found in North Africa and the Horn of Africa, particularly in the form of its subclade J1 (J-M267). Subclades J2a and J2a1b1 are found mostly in Greece, Anatolia, and southern Italy.

[edit] Tree

Below are the subclades of Haplogroup J with their defining mutation, according to the ISOGG tree (as of February 2009). Note that the descent-based identifiers may be subject to change, as new SNPs are discovered that augment and further refine the tree.

  • J (12f2.1, M304, S6, S34, S35)
    • J* Common in Socotra
    • J1 (M267) Found frequently in the Arabian Peninsula, Dagestan, Mesopotamia, the Levant and Semitic-speaking populations of North Africa and Northeast Africa, with a moderate distribution throughout Southwest Asia
      • J1*
      • J1a (M62)
      • J1b (M365)
      • J1c (M390) - formerly J1e
      • J1d (P56)
      • J1e (P58)
        • J1e1 (M367, M368) - formerly J1c
        • J1e2 (M369) - formerly J1d
    • J2 (M172) Found frequently in populations of the Fertile Crescent, Anatolia, Southeast Europe, and the Caucasus, with a moderate distribution throughout Southwest Asia, Central Asia, South Asia, and North Africa
      • J2*
      • J2a (M410)
        • J2a*
        • J2a1 (L26/S57, L27)
          • J2a1*
          • J2a1a (M47, M322)
          • J2a1b (M67 (S51))
            • J2a1b*
            • J2a1b1 (M92, M260)
              • J2a1b1*
              • J2a1b1a (M327)
            • J2a1b2 (M163, M166)
          • J2a1c (M68)
          • J2a1d (M158) - formerly J2a1e
          • J2a1e (M319) - formerly J2a1h
          • J2a1f (M339) - formerly J2a1i
          • J2a1g (M419) - formerly J2a1j
          • J2a1i (P81) (location beneath DYS413≤18, S57 not certain)
          • J2a1j (P279) (location beneath DYS413≤18, S57 not certain)
          • J2a1k (L24, L25)
            • J2a1k1 (DYS 445 < 7) - formerly J2a1h
              • J2a1k1a (M137) - formerly J2a1d
              • J2a1k1b (M289) - formerly J2a1f
              • J2a1k1c (M318) - formerly J2a1g
        • J2a2 (M340)
      • J2b (M12, M314, M221, M102) Mainly found in the Balkans, Greece, Italy, and India (possibly from Neolithic Greeks)*****J2b1 (M205) - formerly J2b1b
          • J2b2 (M241) - formerly J2b1a
            • J2b2*
            • J2b2a (M99) - formerly J2b1a1
            • J2b2b (M280) - formerly J2b1a2
            • J2b2c (M321) - formerly J2b1a3
            • J2b2d (P84)
            • J2b2e (DYS455≤9)

[edit] Subclades

[edit] J1

Haplogroup J1, defined by the 267 marker is most frequent in the Arabian Peninsula Yemen(76%)[1], Saudi (64%) [2], Qatar (58%)[3], and Dagestan (56%)[4]. J1 is generally frequent amongst Arab Bedouins (62%[5]. It is also very common among other Arabs such as those of the southern Levant, i.e. Palestinian Arabs (38.4%) [6], in Algeria (35%)[6], Iraq (28.2%)[6], Tunisia (31%)[7], Syria (30%), Egypt (20%)[8], and the Sinai Peninsula. The frequency of Haplogroup J1 collapses suddenly at the borders of Arabic speaking countries with mainly non-Arabic speaking countries, such as Turkey (9%) and Iran (9.5%) [9]. It is also highly frequent among Jews, especially the Kohanim caste (46%) [1] [10] .

[edit] J2

Haplogroup J2 is found in the highest concentrations in the Fertile Crescent and is found throughout the Mediterranean (including Southern Europe and North Africa), the Balkan peninsula, the Caucasus, the Iranian plateau and into Central Asia[6] and South Asia. More specifically it is found in Iraq, Syria, Lebanon, Palestine, Turkey, Azerbaijan, Israel, Greece, Italy, the Balkans and the eastern coasts of the Iberian Peninsula[11], and most frequently in Lebanese 30% (Wells et al. 2001), Iraqis 29.7% (Sanchez et al. 2005), Syrians 29%, Kurds 28.4%, Iranians 24%[12], Ashkenazi Jews 24%, Palestinian Arabs 16.8%, Sephardic Jews 15.4% [2]

Consistent with its Middle Eastern extent, J2 also includes the Cohen Modal Haplotype.

[edit] J*

Haplogroup J* includes all of J except for J1 and J2. J* is rarely found outside of the island of Socotra, where it is quite frequent at 71.4%[13]. Haplogroup J* also has been found with lower frequency in Oman,[14] Ashkenazi Jews,[15] Pakistan[16], Saudi Arabia,[17] Greece,[14] the Czech Republic,[14][18] and several Turkic peoples.[4][9][19]

[edit] Mutation

The technical details of M304 are:

Nucleotide change: A to C
Position (base pair): 421
Total size (base pairs): 527
Forward 5′→ 3′: caaagtgctgggattacagg
Reverse 5′→ 3′: cttctagcttcatctgcattgt

[edit] Haplotypes

[edit] Modal

DYS 393 390 19 391 385A 385B 426 388 439 389I 392 389II 458 459A 459B 455 454 447 437 448 449 464A 464B 464C 464D
Alleles 12 23 14 10 14 17 11 16 11 13 11 30 17 8 9 11 11 26 14 20 28 13 14 15 16

[edit] Famous

Matt Lauer belongs to Y-DNA haplogroup J.[20]

[edit] See also

[edit] References

  1. ^ *Alshamali et al. 2009 81% (84/104) *Malouf et al. 2008: 70% (28/40) *Cadenas et al. 2008: 45/62 = 72.6% J1-M267
  2. ^ Alshamali F, Pereira L, Budowle B, Poloni ES, Currat M (2009). "Local population structure in Arabian Peninsula revealed by Y-STR diversity". Hum. Hered. 68 (1): 45–54. doi:10.1159/000210448. PMID 19339785. http://content.karger.com/ProdukteDB/produkte.asp?doi=10.1159/000210448. 
  3. ^ Cadenas et al. 2008 42/72 = 58.3% J1-M267
  4. ^ a b Yunusbaev et al. 2006:Dargins (91%), Avars (67%), Chamalins (67%), Lezgins (58%), Tabassarans (49%), Andis (37%), Bagvalins (21.4%))stats combined Dagestan ethnic groups see Dagestan article
  5. ^ 21/32 Nebel et al. 2001
  6. ^ a b c d Semino O, Magri C, Benuzzi G, et al. (May 2004). "Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the Mediterranean area". Am. J. Hum. Genet. 74 (5): 1023–34. doi:10.1086/386295. PMID 15069642. PMC 1181965. http://linkinghub.elsevier.com/retrieve/pii/S0002-9297(07)64366-3. 
  7. ^ combined (Semino et al. 2004 30%) & (Arredi et al. 2004 32%)
  8. ^ Luis JR, Rowold DJ, Regueiro M, et al. (March 2004). "The Levant versus the Horn of Africa: evidence for bidirectional corridors of human migrations". Am. J. Hum. Genet. 74 (3): 532–44. doi:10.1086/382286. PMID 14973781. PMC 1182266. http://linkinghub.elsevier.com/retrieve/pii/S0002-9297(07)61870-9. 
  9. ^ a b Cinnioğlu C, King R, Kivisild T, et al. (January 2004). "Excavating Y-chromosome haplotype strata in Anatolia". Hum. Genet. 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639. http://hpgl.stanford.edu/publications/HG_2004_v114_p127-148.pdf. 
  10. ^ Hammer, Michael F; Doron M Behar and 7 others (2009-08-08). "Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood". Hum Genet (Springer) epub ahead of publication. 
  11. ^ Di Giacomo F, Luca F, Anagnou N, et al. (September 2003). "Clinal patterns of human Y chromosomal diversity in continental Italy and Greece are dominated by drift and founder effects". Mol. Phylogenet. Evol. 28 (3): 387–95. PMID 12927125. http://www.familytreedna.com/pdf/italy.pdf. 
  12. ^ Y haplogroup J in Iran by Alfred A. Aburto Jr.
  13. ^ Viktor Cerny et al. (2008),J*-12f2(xJ1-M267, J2-M172)(45/63)
  14. ^ a b c Di Giacomo F, Luca F, Popa LO, et al. (October 2004). "Y chromosomal haplogroup J as a signature of the post-neolithic colonization of Europe". Hum. Genet. 115 (5): 357–71. doi:10.1007/s00439-004-1168-910.1007/s00439-004-1168-9. PMID 15322918. http://www.ftdna.com/pdf/HaploJ.pdf. 
  15. ^ Shen P, Lavi T, Kivisild T, et al. (September 2004). "Reconstruction of patrilineages and matrilineages of Samaritans and other Israeli populations from Y-chromosome and mitochondrial DNA sequence variation". Hum. Mutat. 24 (3): 248–60. doi:10.1002/humu.2007710.1002/humu.20077. PMID 15300852.  Haplogroup J-M304(xJ1-M267, J2-M172) in 1/20 Ashkenazi Jews.
  16. ^ Firasat et al. (2007), J*-12f2(xJ1-M267, J2-M172): 1.0% (1/97) "Burusho," 3.0% (19/638) "Pakistan"
  17. ^ Khaled K. Abu-Amero, Ali Hellani, Ana M. Gonzalez et al., "Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions," BMC Genetics 2009, 10:59 doi:10.1186/1471-2156-10-59
  18. ^ Luca F, Di Giacomo F, Benincasa T, et al. (January 2007). "Y-chromosomal variation in the Czech Republic". Am. J. Phys. Anthropol. 132 (1): 132–9. doi:10.1002/ajpa.2050010.1002/ajpa.20500. PMID 17078035. 
  19. ^ Alexander Varzari, "Population History of the Dniester-Carpathians: Evidence from Alu Insertion and Y-Chromosome Polymorphisms" (2006)
  20. ^ Famous Haplogroups, ISOGG

[edit] External links

[edit] Phylogenetic tree and Distribution Maps of Y-DNA haplogroup J

[edit] Other


Human Y-chromosome DNA (Y-DNA) haplogroups (by ethnic groups · famous haplotypes)

most recent common Y-ancestor
|
A BT
|
B CT
|
CF DE
| |
C F D E
|
G H IJK
|
IJ K
| |
I J L M NOP S T
|
NO P
| |
N O Q R



Product Results (view all...)

search wiki for    ?
web dir firms image gallery news hov pdf wiki shop video 



↑ top of page ↑about thumbshots